Home   In News   Download   Search   Browse   Statistics   References   Contact Us   Help
About nonAUG
 
Save to File
 
Feedback
>gi|67539949|ref|XM_658657.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6145.2), mRNA
CTGATATTTCGTCAAAAGGTAAACACCGGTCTTCCAGCAGGGTGGGAAGTTCGCCATTCGAACTCCAAAA
ACCTTCCCTACTACTTCAACCCCGCTACCAGAGAGTCACGATGGGAACCTCCAGCGGATACCGATATGGA
GACTCTTAAGATGTACATGGCAACATATCACAGCGGCGCCGCTACTTACCATGAAGCCCCGAGTCAAGAA
GGCAAGATCCGTTGCAGTCACCTCCTAGTCAAGCACAGAGACAGCAGGCGACCGAGCAGCTGGAGGGAGG
CCGAGATTACTCGAACAAAAGAGGAGGCGCGCGAGATTTTGCGCGGTCATCAGGAGCGAATCATGCGAGG
GGAGATCCGGCTCGGAGATCTTGCGATGTCCGAGTCGGACTGCAGTAGTGCTAGGAAGAAGGGCGATCTC
GGCTTCTTTGGCCGTGGTGAAATGCAGAAAGAGTTCGAGGAGGCAGCGTTCGCATTGCAACCGGGTCAAG
TCAGTGACATTGTCGAATCAGGGTCTGGTCTTCATCTCATCGAGCGGTATGTGAGCTTCAGTATGCCTTG
GGTCGCGCTAATCATGTTGTTTTTCACAGGCTACAATAGATATTGTTGGGCATTGTTATTTTGGTATATT
TGA


                  

Copyright (c) 2009 All rights reserved, IIT Kanpur.                   Copyright   | Privacy  |  Disclaimer   |  Accessibility

Laboratory of Computational Biology
Department of Biological Sciences and Bioengineering

Indian Institute of Technology Kanpur -208016
INDIA